Home >  Prevalent phenotypic and genotypic profile of Enterotoxigenic Escherichia coli among Iranian children Shahram Nazarian, Seyed Latif Mousavi G

Prevalent phenotypic and genotypic profile of Enterotoxigenic Escherichia coli among Iranian children Shahram Nazarian, Seyed Latif Mousavi G


Prevalent phenotypic and genotypic profile of Enterotoxigenic Escherichia coli among Iranian children 

Shahram Nazarian, Seyed Latif Mousavi Gargari*,Iraj Rasooli, Masoome Alerasol ,Samane Bagheri,Shakiba Darvish Alipoor

Department of Biology, Shahed University, Tehran-Qom Express Way, Opposite Imam Khomeini's Shrine, Tehran-3319118651, Iran

Category of paper: Original articles 

Running title: Phenotypic and genotypic ETEC profile in Iran 
 
 
 
 
 
 
 
 
 
 
 
 
 

Abstract

Background: Enterotoxigenic Escherichia coli (ETEC) are the most common causes of diarrhea among children. ETEC strains express colonization factors (CFs) mediating adherence to the small intestinal epithelium and entrotoxin inducing diarrhea. The present work was designed to characterize the phenotypes and genotypes of ETEC associated with diarrhea among Iranian children.

Methods:Stool samples from 422 affected children were collected for microbiological testing. Multiplex PCR technique was employed for the detection of the entrotoxin and CFs genes of ETEC strains. Phenotypic detection of the toxins and CFs was used by immunoassay techniques.The strains were analyzed for serogroups, antimicrobial resistance and entrotoxin activity.

Results: Most of  ETEC  isolates were positive for heat labile and heat stable toxins. CFA/I, CS3, CS2 and CS5 were detected from some of the clinical isolates. 33.3% of the isolates did not express CFs. The majority of ETEC isolates were identified as O127 and O128 serotypes. 57% of the strains were resistant to more than one antimicrobial agent. Enterotoxin activity was confirmed by Chinese hamster ovary cell assay, Rabbit ileal loop and adenylate cyclase activation tests. 

Conclusion:Phenotypic and genotypic characterization of regional ETEC could help evaluate the pathogenicity of ETEC in order to efficiently reduce the burden of illness brought about by ETEC. This may lead to development of effective prophylactic measures.

Keywords

  Enterotoxigenic Escherichia coli ;Diarrhea; Virulence gene ; Multiplex PCR 
 

Introduction

Diarrheagenic E.coli strains are known to cause gastrointestinal illness in humans.1 ETEC is an important causative agent of diarrheal disease  associated with morbidity and mortality in children up to 5 years of age.2 ETEC strains have two major virulence determinants: the heat-labile toxin (LT) and heat-stable toxin (ST) and the colonization factors (CFs).3 To cause diseases, ETEC must adhere to the epithelium of the small intestine by means of CFs. Secretory diarrhea is then produced due to the effects of the enterotoxins. Several types of colonization factor antigens,coli surface antigens (CS) and putative colonization factors(PCFs) have been identified of which the most common ones are: CFA/I, CS1 to CS6 and CS21. 3-5 Since ETEC strains have diverse toxins or CFs, therefore it is important to characterize various clinical ETEC isolates with respect to their virulence profiles.

Due to increasing antibiotic resistance among ETEC strains, the knowledge of antimicrobial resistance patterns in different countries is important when prescribing antibiotics and can serve as a guide for implementing public health interventions against diarrheal disease.4,6 ETEC phenotype variability across regions, populations, complicates these efforts over time.3 Gupta et al.  highlighted a need for more information on the distribution of ETEC phenotypes.7 Iran is one of those world regions where ETEC has not been deeply characterized. Hence the present work was designed to characterize the phenotypes and genotypes of enterotoxigenic Escherichia coli associated with diarrhea among Iranian children less than five years of age. With respect to migration of people from surrounding countries to Iran and spread of ETEC infection through these routes, the findings are expected to characterize the bacteria transmitted from neighboring countries with low-Human Development Index. 
 
 

Methods

Bacterial strains

The specimens were obtained from children under 5 years of age. The study was conducted in Iranian communities between April 2009 to October 2011. After initial screening, 422 stool samples were investigated for the presence of ETEC in samples from central, south and north regions of IRAN.  

Genotypic detection of virulence factors

ETEC strains were identified using primers for LT, STp and STh designed to amplify toxin encoding genes (Table 1). Once strains were confirmed by PCR as ETEC, they were tested sequentially to detect genes encoding CFAs with primers listed in Table 1. Reverse transcriptase (RT) was used to analyze CF mRNA expression under culture conditions at 37oC. RT-PCR was conducted using gene specific first strand cDNA from total RNA.

Serotyping

The O serotypes of E.coli strains were determined by agglutination tests in a commercially available serotype kit (Bahar-afshan, Iran) according to the manufacturer’s instruction.

Antimicrobial resistance phenotyping

The commercial grade antimicrobial disks (ampicillin, nalidixic acid, chloramphenicol, tetracycline, ciprofloxacin, gentamicin, cefoxitin, cefalothin, trimethoprim/sulfamethoxazole) . ETEC strains were analyzed for their antimicrobial susceptibilities by disk diffusion method according to The National Committee for Clinical Laboratory Standards breakpoints. 8

Phenotypic detection of toxins and colonization factors

ST production of the isolates was determined by E. COLIST-EIA kits (Denka Seiken, Tokyo, Japan). Ganglioside-GM1-ELISA to detect LT was performed. Microtiter wells were coated with GM1. 100 �l from each of the E. coli strains in LB broth was added to wells and incubated overnight at 37�C. The released LT bound to GM1 was detected with rabbit anti cholera toxin antiserum and goat anti rabbit immunoglobulin conjugated to horseradish peroxidase (Dako, Roskilde, Denmark) using H2O2 and OPD (O-phenylenediamine dihydrochloride) as substrates (Sigma Aldrich). 9Only isolates confirmed to be ETEC by ELISA were further tested for the expression CFs by an immunodot blot assay. 9

Rabbit ileal loop test

New Zealand withes rabbits (1.5 kg) were kept in a starvation condition for 48 h. After general anesthesia, 500 �l aliquots from E.coli strains cultivated in Brain Heart Infusion (BHI) broth containing 107 cfu/ml were injected into each 6 loop in mid portion of the ileum. The animals were sacrificed 18 h later, and the ratio of fluid accumulation against loop length (g/cm) was calculated as an index of enterotoxigenicity.10 Research was conducted in compliance with the Animal Welfare Act and regulations related to experiments involving animals.

Adenylate cyclase activation

The ability of the toxin to stimulate adenylate cyclase was determined by incubating CHO cells with the toxin and measuring the amount of cyclic AMP (cAMP). CHO cells were seeded in 24-well sterile culture plates at a density of 5 � 104 cells/well and were grown overnight to approximately 80% confluence. Bacteria-free BHI culture supernatant was added and the plates were incubated in a CO2 incubator. After a wash with PBS, the cells were lysed with 0.1 M HCl and the lysate was centrifuged. 11 The supernatant was collected and tested for intracellular cAMP levels using a cAMP immunoassay kit (Abnova). 

ETEC binding assay

ETEC strains were subjected to a Caco-2 adhesion test with the method described by Taniguchi et al. The number of ETEC cells adhering to each Caco-2 cell was counted and the adhesion index was determined by examining 100 Caco-2 cells.12

Statistical analyses

Binding of the bacteria to the cells was expressed as the mean percentage of cells with bound bacteria � standard deviation. Results were obtained from three different experiments.

Results

Clinical data

A total of 422 samples were collected and screened for presence of E.coli strains.

295 of the fecal samples (69.9%) were positive for E.coli. Twenty one (4.97%) of samples was detected as ETEC positive. ETEC affected patients had an average age of 28.23 months, with 42.85 % (9 Nos.) under 24 months old (Table 2). The most common symptoms were watery stools, vomiting and abdominal pain. Sex distribution among the children affected with ETEC were 12 female (57.14%), and 9 male (42.85%) (Table 2).

Genotypic characterization of ETEC isolates

The ETEC strains analyzed for enterotoxin genes by multiplex PCR lead to detection of LT (one), STH (four), LT/STH (15) and LT/STP (one) strains with no non specific product. Agarose gel electrophoresis of PCR products showed the genes for colonization factors with the expected size. Colonization factor antigen I was the most common CF, followed by CS3, CS2 and CS5. Some ETEC strains (33.3%) did not express any detectable colonization factors (CFA/I,CS1-CS6) (Table 2). Further analysis of colonization factors with RT-PCR showed mRNA production from genes encoding colonization factor.  

Phenotypic detection of colonization factors

Dot blot analysis based on Abs for colonization factors was used. Comparisons of strains for colonization factors by dot blot analysis and PCR showed a high level of agreement. Only one PCR positive strain for CFA/I was not detected by dot blot assay.

Examination of Caco-2 cell monolayers revealed that ETEC H10407 cells and CFA/I, CS2, CS3, CS5 positive clinical strains were distributed on the Caco-2cells. Almost all the Caco-2 cells were observed to bind one or more bacteria with an adhesion index of 14.5 bacteria per cell for H10407 and 13.5� 0.8, 10.6�0.9, 8.7�0.8 and 6�0.6 bacteria per cell for CFA/I, CS2, CS3, CS5 positive clinical strains respectively.

 Phenotypic detection of enterotoxins

ST and LT expression by ST detection kit and GM1-ELISA are given in Table 2. LT/ST producing ETECs were the most frequently detected strains. One ETEC strain was found to be eltB positive by multiplex PCR but LT negative by GM1-ELISA.Stimulation of the cAMP levels in cell culture after addition of bacterial culture supernatant indicated LT release and its toxic activity (Fig. 1). Fluid accumulation in ligated-gut-loop further confirmed the in vivo entrotoxic activity of isolated strains. The loops inoculated with clinical strains had a fluid accumulation ratio of 1.31 - 1.89.

Serotyping

Serotyping of ETEC isolates for detecting somatic antigens are presented in Table 2. A wide array of O-type were observed among the 16 (76.19 %) of the total ETEC isolates. Serogroups O20, O128, O6 and O8 typically associated with ETEC, were also detected. The majority of ETEC isolates were serotyped as O127 and O86. 
 

Antimicrobial drug susceptibility

Antimicrobial drug susceptibility test results showed that of ETEC isolates 38% were resistant to tetracycline, 71.4% to ampicillin, 19% to chloramphenicol, 57.1% to sulfamethoxazole-trimethoprim, 19% to cephalothin, 47.6% amoxicillin–clavulanate and 9.5% to ciprofloxacin. Most strains were not resistant to Ciprofloxacin and all the tested strains were susceptible to nalidixic acid and gentamicin. In our study, 57% of the isolates were resistant to more than one antimicrobial agent and 14.28% of strains were resistant to more than four antibiotics.

Discussion

ETEC is one of the most common bacteria responsible for diarrhea in different parts of the world .Prevalence of ETEC from Iranian patients with diarrhea referred to hospitals and medical centers in the central, south and north of IRAN was studied in the present work. Multiplex PCR findings were supported by toxin ELISA results for all ETEC strains. However, one strain was found to be eltB positive by multiplex PCR but LT negative by ELISA. It is likely that this strain contains silent genes or enterotoxin level inadequate for the detection by ELISA.  The results showed that LT/ST-ETEC was the most commonly detected ETEC enterotoxin subgroup. A total of 50 studies assessing the relative frequency of the three ETEC enterotoxin subgroups indicated that ST-ETEC was the most common enterotoxin subgroup.7 In Iran, Katouli et al. showed that ST was the most frequent toxin type (60%) followed by LT/ST and LT.13 In fact, these studies on ETEC strains isolated shows that there has been a change in the prevalence of enterotoxin toxin types from 1992 until now.

PCR method for detection of colonization factors is high sensitive and affordable, however the occurrence of mutations in the primer binding site can cause errors in PCR amplification.9 In phenotypic detection of colonization factors, phenotypic silencing could be due to storage and subculture of ETEC isolates. This feature may have a genetic explanation such as loss of regulatory genes. 9 In our ETEC strains, CFA/I and CS3 were the most common CF combinations detected with the multiplex PCR. Such an observation was reported in a review by Isidean and co workers that CS3 alone was the predominant phenotype  among CFA/II-expressing ETEC. 3 CFA/I-expressing strains were common in different parts of the world.3 Shahrokhi et al. showed that CFA/I and CFA/IV were the most common CF types within ETEC isolates. 14 Although CS6-producing ETEC is the most prevalent strain of ETEC in various developing countries7,15, none of the ETEC isolates in our study had CS6 antigen. The CFs were also detected by dot blot indicating that the genes were translated and displayed on bacterial surface. The local and regional enterotoxin type distributions are related to the estimation of vaccine coverage against ETEC strains. Using a multivalent  vaccine containing LT toxoid, and the most common CFs as a model and the data from this study, the estimated vaccine coverage rate in children in IRAN is expected to be 80.95%  against toxin and 66.6% against CFs. High resistance to antibiotics in E.coli has been previously reported in Iranian isolates. 14,16 The pattern of multidrug resistance in our isolates is similar to those reported by Aslani et.al.16 The results indicate wide spread antimicrobial property of ETEC strains suggesting limited antimicrobial treatment to be considered against ETEC diarrhea unless for more severe or persistent cases. This attempt would hamper further development of antimicrobial resistance. There was a wide diversity of O antigens represented among the ETEC isolated from children in this study. Of a great variety of O serogroups identified in ETEC, serotypes O6, O8, O78, O128 and O153 are the most common antigens.17 This result further confirms that ETEC from different geographical areas belonged to a relatively large number of serotypes and ETEC serotypes may change over time.17,18

Ecology and pathogenicity of ETEC help reduce burden of the illness. Effective prophylactic measures could develop by phenotypic and genotypic characterization of regional ETEC.

Acknowledgment

The authors wish to thank Shahed University for the sanction of grants to conduct the present study. We also declare no conflict of interests. 
 

References

     1.  Vilchez S, Reyes D, Paniagua M, Bucardo F, Mollby R, Weintraub A. Prevalence of diarrhoeagenic Escherichia coli in children from Leon, Nicaragua. J Med Microbiol 2009; 58:630-7.

     2.  Franca EL, Bitencourt RV, Fujimori M, Cristina de Morais T, de Mattos Paranhos Calderon I, Honorio-Franca AC. Human colostral phagocytes eliminate enterotoxigenic Escherichia coli opsonized by colostrum supernatant. J Microbiol Immunol Infect 2011; 44:1-7.

     3.  Isidean SD, Riddle MS, Savarino SJ, Porter CK. A systematic review of ETEC epidemiology focusing on colonization factor and toxin expression. Vaccine 2011; 29:6167-78.

     4.  Rodas C, Mamani R, Blanco J, Blanco JE, Wiklund G, Svennerholm AM et al. Enterotoxins, colonization factors, serotypes and antimicrobial resistance of enterotoxigenic Escherichia coli (ETEC) strains isolated from hospitalized children with diarrhea in Bolivia. Braz J Infect Dis 2011; 15:132-7.

     5.  Svennerholm AM, Lundgren A. Recent progress toward an enterotoxigenic Escherichia coli vaccine. Expert Rev Vaccines 2012; 11:495-507.

     6.  Garcia PG, Silva VL, Diniz CG. Occurrence and antimicrobial drug susceptibility patterns of commensal and diarrheagenic Escherichia coli in fecal microbiota from children with and without acute diarrhea. J Microbiol 2011; 49:46-52.

     7.  Gupta SK, Keck J, Ram PK, Crump JA, Miller MA, Mintz ED. Part III. Analysis of data gaps pertaining to enterotoxigenic Escherichia coli infections in low and medium human development index countries, 1984-2005. Epidemiol Infect 2008; 136:721-38.

     8.  Clinical Laboratory Standards Institute (CLSI).Performance standards for antimicrobial susceptibility testing; Eighteenth informational supplement. CLSI document M100-S18 . Wayne, PA, USA: CLSI; 2008.

     9.  Sjoling A, Wiklund G, Savarino SJ, Cohen DI, Svennerholm AM. Comparative analyses of phenotypic and genotypic methods for detection of enterotoxigenic Escherichia coli toxins and colonization factors. J Clin Microbiol 2007; 45:3295-301.

     10.  De SN, Chatterje DN. An experimental study of the mechanism of action of Vibrio cholerae on the intestinal mucous membrane. J Pathol Bacteriol 1953; 66:559-62.

     11.  Tokuhara D, Yuki Y, Nochi T, Kodama T, Mejima M, Kurokawa S et al. Secretory IgA-mediated protection against V. cholerae and heat-labile enterotoxin-producing enterotoxigenic Escherichia coli by rice-based vaccine. Proc Natl Acad Sci 2010; 107:8794-9.

     12.  Taniguchi T, Akeda Y, Haba A, et al. Gene cluster for assembly of pilus colonization factor antigen III of enterotoxigenic Escherichia coli. Infect Immun. 2001; 69:5864-73.

     13.  Katouli M, Jaafari A, Ketabi GR. The role of diarrhoeagenic Escherichia coli in acute diarrhoea1 diseases in Bandar-Abbas, Iran. J Med Microbiol 1988; 27:71-4.

     14.  Shahrokhi N, Bouzari S, Jafari A. Comparison of virulence markers and antibiotic resistance in enterotoxigenic Escherichia coli isolated ten years apart in Tehran. J Infect Dev Ctries 2011; 5:248-54.

     15.  Shaheen HI, Abdel Messih IA, Klena JD, Mansour A, El-Wakkeel Z, Wierzba TF et al. Phenotypic and genotypic analysis of enterotoxigenic Escherichia coli in samples obtained from Egyptian children presenting to referral hospitals. J Clin Microbiol 2009; 47:189-97.

     16.  Aslani MM, Ahrabi SS, Alikhani YM, Jafari F, Zali RM, Mani M. Molecular detection and antimicrobial resistance of diarrheagenic Escherichia coli strains isolated from diarrheal cases. Saudi Med J 2008; 29:388-92.

     17.  Wolf MK. Occurrence, distribution, and associations of O and H serogroups, colonization factor antigens, and toxins of enterotoxigenic Escherichia coli. Clin Microbiol Rev 1997; 10:569-84.

     18.  Shaheen HI, Khalil SB, Rao MR, Abu ER, Wierzba TF, Peruski LF, Jr. et al. . Phenotypic profiles of enterotoxigenic Escherichia coli associated with early childhood diarrhea in rural Egypt. J Clin Microbiol 2004; 42:5588-95. 
     
     
     
     

Figure legends

Figure 1. Toxicity activity detected in cAMP ELISA. Results carried out with H10407 and E.coli 25922 strains as positive and negative controls. WT1-17: ETEC strain containing LT toxin gene. 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Table 1 Primers sequences used for amplification of toxin and colonization factor of ETEC 


virulence factor

 

Target gene primer sequence Product

(bp)

GenBank

accession no

Forward Reverse
LT eltBI TCTTTATGATCACGCGAGAGGA TCTTCTCTCCATAGCTTGGTGATC 412 S60731.1
STH estA2-4 TGCTAAACCAGTAGAGTCTTCAAAAG TAATAGCACCCGGTACAAGCAG 157 M29255.1
STP estA1 AGGTAACATGAAAAAGCTAATGTTG AGGCAGGATTACAACAAAGTTCA 209 M58746.1
CFA/1 cfaB ACAATGTTTGTAGCAGTGAGTGC AGATACTACTCCTGAATAGTTTCCTG 450 M55661.1
CS1 csoA ACTGTTGACCTTCTGCAATCTGATG ACGTTGACTGAGTCAGGATAATTG 403 AY513487.1
CS2 cotA ACTATCGATCTGATGCAATCTGATG TACAATATTAGTTTGCTGGGTGC 355 Z47800.1
CS3 cstA TCCTCAGGATAATTTAACATTATCC ACCTTCAGTGGTAATAAACTTAACTG 304 X16944.1
CS4 csaB TAGTAGTTTACCTACTGCTGTAGAATTAA GACGTTCCAAATTTAATTCTGC 252 AF296132.1
CS5 csfA TCCTTCCGCTCCCGTTA TAGCTGACGTGTCACGCGT 206 AJ224079.2
CS6 cssA TGATGATTCCCAATCAATAATCTAC AGGTATTTCTTTATCTCCGCATG 142 U04844.1
CS21 lngA TGCTGGAAGTTATCATTGTTCTTG ACTTAGAATTTTGTCTGCAGTCAAG 569 AF004308.1
 
 
 
 
 
 
 
 
 
 

Table 2 Characterized ETEC strains collected from Iranian children with diarrhea


Children Characteristics of strains
Patient ID Age Sex Diarrhea Vomiting Toxins CFs O serotypes
19 29m F Watery stool + LT/STH CFA/I O127
25 28m F Watery stool + LT CFA/I NT
51 36m F Watery stool + LT/STH CS2 O6
56 28m M Watery stool + LT/STH CS3 O86
71 22m F Watery stool + LT/STH     - O26
85 30m M Watery stool + LT/STH CS3 O86
89 24m M Watery stool - LT/STH CFA/I NT
105 20m F Mucosal stool - LT/STH     - O55
130 28m M Watery stool + LT/STH CS3 O86
141 34m F Mucosal stool + STH     - O127
152 20m M Watery stool + LT/STH CFA/I O127
198 34m F Watery stool - LT/STH     - O111
210 28m M Watery stool + STH CFA/I NT
212 24m F Blood stool + LT/STH CFA/I O78
320 18m F Watery stool + LT/STP      - O114
354 20m M Watery stool - STH CFA/I NT
362 26m M Mucosal stool - STH CFA/I O127
385 30m F Watery stool - LT/STH CFA/I O127
401 28m F Mucosal stool - LT/STH CS5 O128
403 24m F Watery stool + LT/STH    - NT
420 20m M Watery stool + LT/STH    - O20

 

    * Corresponding author: Department of Biology, Shahed University, Tehran-Qom Express Way, Opposite Imam Khomeini's shrine, Tehran-3319118651, Iran

    Tel,: +98(21)51212600; Fax: +98(21)51212601 E-mail address: slmousavi@shahed.ac.ir

Set Home | Add to Favorites

All Rights Reserved Powered by Free Document Search and Download

Copyright © 2011
This site does not host pdf,doc,ppt,xls,rtf,txt files all document are the property of their respective owners. complaint#downhi.com
TOP